Review



algorithms imagej schneider  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Bio-Rad algorithms imagej schneider
    Algorithms Imagej Schneider, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 4012 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/CFX+Maestro+Software/pm41722047-185-241-252
    Average 98 stars, based on 4012 article reviews
    algorithms imagej schneider - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Software:

    Article Title: ZFAND1 Recruits p97 and the 26S Proteasome to Promote the Clearance of Arsenite-Induced Stress Granules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER FLAG-ZFAND1 (pCMV2B) This study pAB2305 ZFAND1-FLAG (pCMV4A) This study pAB2394 FLAG-ZFAND1DUBL (pCMV2B) This study pAB2306 ZFAND1DUBL-FLAG (pCMV4A) This study pAB2487 FLAG-ZFAND1 ZnFmut (pCMV2B) This study pAB2375 ZFAND1 ZnFmut-FLAG (pCMV4A) This study pAB2392 FLAG-ZFAND1 R130* (pCMV4A) This study pAB2473 ZFAND1 no tag (pCMV4A) This study pAB2381 ZFAND1 ZnFmut no tag (pCMV4A) This study pAB2387 FLAG-ZFAND2B (pCMV2B) This study pAB2309 FLAG-Cuz1 (pCMV2B) This study pAB2308 ZFAND2A no tag (pCMV4A) This study pAB2384 myc-p97-E578Q (pCMV3B) Buchberger lab collection pAB2174 FLAG-p97 (pCMV2B) Fernández-Sáiz and Buchberger, 2010 pAB1331 FLAG-p97R155H (pCMV2B) Fernández-Sáiz and Buchberger, 2010 pAB1333 pOG44 Life Technologies pAB1953 pcDNA5-FRT/TO Life Technologies pAB1952 FLAG-ZFAND1 (pcDNA5-FRT/TO) This study pAB2342 ZFAND1-FLAG (pcDNA5-FRT/TO) This study pAB2344 GST-Cuz1 (pGEX4T3) This study pAB2203 GST-ZFAND1 (pGEX4T1) This study pAB2067 PBP1-GFP EDC3-mCherry; 2micron Swisher and Parker, 2010 pRP1944 YCplac33 Gietz and Sugino, 1988 pAB826 YCplac33-CUZ1 This study pAB1029 pX330 Addgene pAB2389 pX330-sgRNA1 This study pAB2402 pX330-sgRNA2 This study pAB2403 Software and Algorithms ImageJ https://imagej.nih.gov/ij/ RRID: SCR_003070 Fiji http://fiji.sc RRID: SCR_002285 Image Lab Software Bio-Rad RRID: SCR_014210 .. REAGENT or RESOURCE SOURCE IDENTIFIER FLAG-ZFAND1 (pCMV2B) This study pAB2305 ZFAND1-FLAG (pCMV4A) This study pAB2394 FLAG-ZFAND1DUBL (pCMV2B) This study pAB2306 ZFAND1DUBL-FLAG (pCMV4A) This study pAB2487 FLAG-ZFAND1 ZnFmut (pCMV2B) This study pAB2375 ZFAND1 ZnFmut-FLAG (pCMV4A) This study pAB2392 FLAG-ZFAND1 R130* (pCMV4A) This study pAB2473 ZFAND1 no tag (pCMV4A) This study pAB2381 ZFAND1 ZnFmut no tag (pCMV4A) This study pAB2387 FLAG-ZFAND2B (pCMV2B) This study pAB2309 FLAG-Cuz1 (pCMV2B) This study pAB2308 ZFAND2A no tag (pCMV4A) This study pAB2384 myc-p97-E578Q (pCMV3B) Buchberger lab collection pAB2174 FLAG-p97 (pCMV2B) Fernández-Sáiz and Buchberger, 2010 pAB1331 FLAG-p97R155H (pCMV2B) Fernández-Sáiz and Buchberger, 2010 pAB1333 pOG44 Life Technologies pAB1953 pcDNA5-FRT/TO Life Technologies pAB1952 FLAG-ZFAND1 (pcDNA5-FRT/TO) This study pAB2342 ZFAND1-FLAG (pcDNA5-FRT/TO) This study pAB2344 GST-Cuz1 (pGEX4T3) This study pAB2203 GST-ZFAND1 (pGEX4T1) This study pAB2067 PBP1-GFP EDC3-mCherry; 2micron Swisher and Parker, 2010 pRP1944 YCplac33 Gietz and Sugino, 1988 pAB826 YCplac33-CUZ1 This study pAB1029 pX330 Addgene pAB2389 pX330-sgRNA1 This study pAB2402 pX330-sgRNA2 This study pAB2403 Software and Algorithms ImageJ https://imagej.nih.gov/ij/ RRID: SCR_003070 Fiji http://fiji.sc RRID: SCR_002285 Image Lab Software Bio-Rad RRID: SCR_014210 .. All experiments were performed in the human HEK293 and HeLa cell lines and their derivatives, or in the budding yeast Saccharomyces cerevisiae in the DF5 background.

    Article Title: An mTOR-Stat3-Stathmin pathway controls centrosome and microtubule dynamics for oocyte polarization.
    Article Snippet: KASP-PCR was performed on an Applied Biosystems StepOnePlus machine and following the manufacturer instructions, using the following SNP sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAAAACTGAAACTAATATTTAGCTATTGCTTGGGTATAACCTCTTACTCATC CTCCACAGGACA[TGGAGCA/-]GAAGATGAAAATGTTGGA GAATCTGCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGTG CTGGA .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Stathmin Forward: CAAGCCTGGAAC TCTCTGAAG; Reverse: CTGGATCTCCACCA AGGAAAG; Ddx4 Forward 5 ′ -GGTCGTGGA AAGATTGGCCTG-3 ′ ,Ddx4 Reverse 5 ′ -CAGCAGC CATTCTTTGAATATCTTC-3 ′ ; Beta actin Forward: 5 ′ -GGATTCGCTGGAGATGATGC; Reverse: 5 ′ – CGTGCTCGATGGGGTACTTC; HCR Probes: foxl2l; rec8a; dmc1 This paper; Molecular Instruments; Molecular Instruments; Molecular Instruments N/A; (accession #NM_001128810.1); (accession # XM_017359108.1); (#NM_001020782.1) KASP primer: stat3 stl27 Genotyping SNP primer sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAA AACTGAAACTAATATTTAGCTATTGCTTGGGTATAAC CTCTTACTCATCCTCCACAGGACA[TGGAGCA/-] GAAGATGAAAATGTTGGAGAATCTGCAGGATGATTTT GATTTCAACTACAAAACTCTTAAGAGTGCTGGA Kbioscience; This Paper N/A Software and algorithms ImageJ https://imagej.nih.gov/ij/ https://imagej.nih.gov/ij/ Image Lab 4.1 Bio-Rad https://www.bio-rad.com/en-il/ product/image-lab-software? .. ID=KRE6P5E8Z IMARIS Oxford Instruments https://imaris.oxinst.com/ R (version 4.5.0) using RStudio Posit (formerly RStudio, PBC) https://posit.co/download/rstudio-desktop/ Ingenuity Pathway Analysis (IPA) QIAGEN Inc. https://digitalinsights.qiagen.com/IPA Prism GraphPad https://www.graphpad.com/features e2 Current Biology 35, 1–16.e1–e4, December 15, 2025 Article

    Article Title: β1 integrin signaling governs necroptosis via the chromatin-remodeling factor CHD4.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ATAC-seq data This paper GEO database: GSE229795 Experimental models: Cell lines b1-WT R. T. Bottcher et al.46 N/A b1-KO R. T. Bottcher et al.46 N/A pKO-aV H. B. Schiller et al.4 N/A pKO-aV/b1 H. B. Schiller et al.4 N/A pKO-b1 H. B. Schiller et al.4 N/A b1-KO Chd4 KO clone #1, #2, #3 This paper N/A b1-KO Gatad2a/b DKO clone #1, #2, #3 This paper N/A L929 ATCC NCTC clone 929 .. MOVAS Ripk3 KO This paper N/A B16-F10 ATCC CRL-6475 Panc02 CLS CVCL_D627 Experimental models: Organisms/strains Mouse: C57BL/6J Janvier N/A Oligonucleotides Primers for qPCR, see Table S2 This paper N/A ON-TARGETplus Mouse Chd4 SMARTPool Dharmacon L-052142-00-0005 Software and algorithms ImageJ https://ImageJ.nih.gov/ij/index.html Image Lab Software version 6.0 Bio-Rad Laboratories https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z GraphPad Prism version 9.0 GraphPad Prism software https://www.graphpad.com/ ..

    Sequencing:

    Article Title: An mTOR-Stat3-Stathmin pathway controls centrosome and microtubule dynamics for oocyte polarization.
    Article Snippet: KASP-PCR was performed on an Applied Biosystems StepOnePlus machine and following the manufacturer instructions, using the following SNP sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAAAACTGAAACTAATATTTAGCTATTGCTTGGGTATAACCTCTTACTCATC CTCCACAGGACA[TGGAGCA/-]GAAGATGAAAATGTTGGA GAATCTGCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGTG CTGGA .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Stathmin Forward: CAAGCCTGGAAC TCTCTGAAG; Reverse: CTGGATCTCCACCA AGGAAAG; Ddx4 Forward 5 ′ -GGTCGTGGA AAGATTGGCCTG-3 ′ ,Ddx4 Reverse 5 ′ -CAGCAGC CATTCTTTGAATATCTTC-3 ′ ; Beta actin Forward: 5 ′ -GGATTCGCTGGAGATGATGC; Reverse: 5 ′ – CGTGCTCGATGGGGTACTTC; HCR Probes: foxl2l; rec8a; dmc1 This paper; Molecular Instruments; Molecular Instruments; Molecular Instruments N/A; (accession #NM_001128810.1); (accession # XM_017359108.1); (#NM_001020782.1) KASP primer: stat3 stl27 Genotyping SNP primer sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAA AACTGAAACTAATATTTAGCTATTGCTTGGGTATAAC CTCTTACTCATCCTCCACAGGACA[TGGAGCA/-] GAAGATGAAAATGTTGGAGAATCTGCAGGATGATTTT GATTTCAACTACAAAACTCTTAAGAGTGCTGGA Kbioscience; This Paper N/A Software and algorithms ImageJ https://imagej.nih.gov/ij/ https://imagej.nih.gov/ij/ Image Lab 4.1 Bio-Rad https://www.bio-rad.com/en-il/ product/image-lab-software? .. ID=KRE6P5E8Z IMARIS Oxford Instruments https://imaris.oxinst.com/ R (version 4.5.0) using RStudio Posit (formerly RStudio, PBC) https://posit.co/download/rstudio-desktop/ Ingenuity Pathway Analysis (IPA) QIAGEN Inc. https://digitalinsights.qiagen.com/IPA Prism GraphPad https://www.graphpad.com/features e2 Current Biology 35, 1–16.e1–e4, December 15, 2025 Article

    Real-time Polymerase Chain Reaction:

    Article Title: β1 integrin signaling governs necroptosis via the chromatin-remodeling factor CHD4.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ATAC-seq data This paper GEO database: GSE229795 Experimental models: Cell lines b1-WT R. T. Bottcher et al.46 N/A b1-KO R. T. Bottcher et al.46 N/A pKO-aV H. B. Schiller et al.4 N/A pKO-aV/b1 H. B. Schiller et al.4 N/A pKO-b1 H. B. Schiller et al.4 N/A b1-KO Chd4 KO clone #1, #2, #3 This paper N/A b1-KO Gatad2a/b DKO clone #1, #2, #3 This paper N/A L929 ATCC NCTC clone 929 .. MOVAS Ripk3 KO This paper N/A B16-F10 ATCC CRL-6475 Panc02 CLS CVCL_D627 Experimental models: Organisms/strains Mouse: C57BL/6J Janvier N/A Oligonucleotides Primers for qPCR, see Table S2 This paper N/A ON-TARGETplus Mouse Chd4 SMARTPool Dharmacon L-052142-00-0005 Software and algorithms ImageJ https://ImageJ.nih.gov/ij/index.html Image Lab Software version 6.0 Bio-Rad Laboratories https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z GraphPad Prism version 9.0 GraphPad Prism software https://www.graphpad.com/ ..



    Similar Products

    99
    Oxford Instruments algorithms imagej nih
    Algorithms Imagej Nih, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/Imaris/pm41824461-294-101-105
    Average 99 stars, based on 1 article reviews
    algorithms imagej nih - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Fisher Scientific algorithms fiji imagej n a rrid scr 002285 other
    Algorithms Fiji Imagej N A Rrid Scr 002285 Other, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/002285+a+algorithms+fiji+imagej+n+other+rrid+scr/pm41518617-38-161-171
    Average 86 stars, based on 1 article reviews
    algorithms fiji imagej n a rrid scr 002285 other - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Nikon algorithms fiji imagej nih
    Algorithms Fiji Imagej Nih, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/NIS-Elements/pm41861814-221-189-197
    Average 99 stars, based on 1 article reviews
    algorithms fiji imagej nih - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    Bio-Rad algorithms imagej schneider
    Algorithms Imagej Schneider, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/CFX+Maestro+Software/pm41722047-185-241-252
    Average 98 stars, based on 1 article reviews
    algorithms imagej schneider - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    Oxford Instruments algorithms imagej fiji schneider
    Algorithms Imagej Fiji Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/Imaris/pm41689806-832-115-121
    Average 99 stars, based on 1 article reviews
    algorithms imagej fiji schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Nikon algorithms imagej nih
    Algorithms Imagej Nih, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/NIS-Elements/pm41679297-807-50-57
    Average 99 stars, based on 1 article reviews
    algorithms imagej nih - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad algorithms image lab software bio rad imagej nih rrid scr 001935 url
    Algorithms Image Lab Software Bio Rad Imagej Nih Rrid Scr 001935 Url, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/Image+Lab+Software/pm41512867-588-28-32
    Average 99 stars, based on 1 article reviews
    algorithms image lab software bio rad imagej nih rrid scr 001935 url - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Matrix Science algorithms brainwave 5 software 3brain n a imagej
    Algorithms Brainwave 5 Software 3brain N A Imagej, supplied by Matrix Science, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej/3brain+5+a+algorithms+brainwave+imagej+n+software/pm41643681-723-21-68
    Average 86 stars, based on 1 article reviews
    algorithms brainwave 5 software 3brain n a imagej - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results